Essay on Genes and Genomes

Submitted By xxemxx
Words: 1658
Pages: 7

Conifer Translational Genomics Network
Coordinated Agricultural Project

Genomics in Tree Breeding and
Forest Ecosystem Management
-----

Module 2 – Genes, Genomes, and
Mendel
Nicholas Wheeler & David Harry – Oregon State University www.pinegenome.org/ctgn Quick review: Genes and genomes
 In eukaryotes, DNA is found in the... – Nucleus
– Mitochondria
– Chloroplasts (plants)

 Organelle inheritance is often uniparental, making it powerful for certain types of applications Figure Credit: Wikipedia Contributors, http://commons.wikimedia.org/w/index.php?title=File:Plant_cell_structure.png&oldid=45093602

www.pinegenome.org/ctgn

Chromosomes
Linear strands of DNA and associated proteins in the nucleus of eukaryotic cells
 Chromosomes carry the genes and function in the transmission of hereditary information

 Diploid cells have two copies of each chromosome  One copy comes from each parent

 Paternal and maternal chromosomes may have different alleles

Image Credit: Jane Ades, National Human Genome Research Initiative (NHGRI)

www.pinegenome.org/ctgn

Genes
Units of information on heritable traits
 In eukaryotes, genes are distributed along chromosomes  Each gene has a particular physical location: a locus
 Genes encompass regulatory switches and include both coding and non-coding regions  Genes are separated by intergenic regions whose function is not understood
Figure Credit: Darryl Leja, National Human Genome Research Initiative

www.pinegenome.org/ctgn

The central dogma of molecular biology

Figure Credit: Modified from Jeff Dean, University of Georgia

www.pinegenome.org/ctgn

Alleles
Alternative forms of a gene
 A diploid cell has two copies of each gene (i.e. two alleles) at each locus
 New alleles arise through mutation

 Alleles on homologous chromosomes may be the same or different (homozygous vs. heterozygous)

Figure Credit: Megan McKenzie-Conca, Oregon State University

www.pinegenome.org/ctgn

Markers reflect genetic polymorphisms that are inherited in a Mendelian fashion
 DNA markers 'mark' locations where DNA sequence varies (2 or more alleles)
– Such polymorphisms can vary within and among individuals (e.g. heterozygotes vs. homozygotes) and populations

 Markers may be located in genes or elsewhere in the genome
– Historically, we've had too few markers to inform breeding

 Genomics tools provide an almost unlimited supply of markers

www.pinegenome.org/ctgn

Mutations may take many forms
 Some simple, single nucleotide mutations can totally alter a protein product by producing a frameshift. This results in a new amino acid being produced
 Insertions and deletions: The addition or loss of one or more nucleotide(s) in coding sequence www.pinegenome.org/ctgn

Figure Credit: Modified from Lewin, 2000.

Single Nucleotide Polymorphisms
(SNPs) embedded within a DNA sequence
 DNA sequences are aligned
 Polymorphic sites are identified
 Haplotypes (closely linked markers of a specific configuration) are deduced by direct observation or statistical inference

*
*
* atggctacctgaactggtcaactcatcgaaagctaa atggctacctgaactggtcaactcatcgaaagctaa atgcctacctgaactggtcaactcatcgaaagctaa atgcctacctgaactggtcaactcatcgaaggctaa atgcctacctgaactggtcaacacatcgaaggctaa Figure Credit: David Harry, Oregon State University

www.pinegenome.org/ctgn

1
1
2
3
4

Single Nucleotide Polymorphism (SNP)
SNP

Tree 1

Tree 2

Tree 3

A C G T G T C G G T C T T A
A C G T G T C A G T C T T A

Maternal chrom.

A C G T G T C G G T C T T A
A C G T G T C G G T C T T A

Maternal chrom.

A C G T G T C A G T C T T A
A C G T G T C A G T C T T A

Maternal chrom.

Tree 1 is heterozygous

Paternal chrom.

Paternal chrom.

Trees 2 and 3 are homozygous

Figure Credit: Glenn Howe, Oregon State University

www.pinegenome.org/ctgn

Paternal chrom.

The genome
An individual’s complete genetic complement
 For eukaryotes, a haploid set of chromosomes
 For bacteria, often a single chromosome
 For viruses, one or a few DNA or RNA molecules
…